Please use this identifier to cite or link to this item: http://riu.ufam.edu.br/handle/prefix/1216
metadata.dc.type: Relatório de Pesquisa
Title: Identificação de Fungos Endofíticos Isolados de Manihot esculenta Crantz., utilizando marcador molecular ITS.
metadata.dc.creator: Geíza Carmem Batista de Souza
metadata.dc.contributor.advisor1: José Odair Pereira
metadata.dc.description.resumo: A mandioca é atacada por mais de 30 agentes causadores de doenças, dentre eles fungos, bactérias e vírus. Alguns destes agentes estão distribuídos em toda parte do mundo onde se tem plantação de mandioca. Microrganismos endofíticos, geralmente fungos e bactérias, vivem sistematicamente no interior das plantas, sem causar aparentemente dano a seus hospedeiros. Os marcadores moleculares de DNA têm sido utilizados com sucesso para identificar espécies de fungos ou linhagens intraespecíficas. Assim, com o objetivo de identificar em nível de espécie, os fungos isolados de folhas, caules e raízes de mandioca (Manihot esculenta Crantz.) por meio de marcadores moleculares da região ITS do DNA ribossomal, serão selecionados endófitos que se encontram armazenados em água pelo método de Castelani. Fragmentos serão inoculados em meio BDA, em placas de Petri, para crescimento vegetativo, esporulação e obtenção de culturas monospóricas por meio de diluição seriada. Após a esporulação, pequenos discos com micélio e esporos serão transferidos para Erlenmeyer contendo 100mL de meio batata-dextrose, acondicionados à temperatura ambiente por um período de dez dias para crescimento micelial e posterior extração. A extração de DNA genômico será realizada pelo método fenol/clorofórmio, para desnaturação e precipitação de proteínas, o tampão de extração (SDS), para rompimento da membrana celular, NaCl e etanol 100% para a precipitação do DNA, etanol 70% para limpeza do DNA e o Tris-HCl e EDTA, para estabilizar o pH da solução em 8 e para reduzir o efeito indesejável da oxidação de compostos fenólicos, respectivamente. Na fase de quantificação do DNA, será estimada a sua concentração com 2µL do DNA e 3µL do tampão da amostra (5X). A quantificação será realizada por eletroforese em gel de agarose 0,8%, corado com brometo de etídio, a leitura realizada pela intensidade de fluorescência num fotodocumentador de imagens com luz ultravioleta. A amplificação de parte do DNA ribossomal de cada indivíduo será realizada via PCR (Reação em Cadeia da Polimerase) utilizando-se o par de primers ITS1 5 TCCGTAGGTGAACCTGCGG 3 e ITS2 5 GCTGCGTTCTTCATCGATGC 3 , que corresponde ao fragmento 3 da subunidade menor do rDNA, a região 5,8S do rDNA e as regiões espaçadoras internas (ITS) 1 e 2 contendo 1600 pares de bases. Os produtos da amplificação serão submetidos à eletroforese horizontal em gel de agarose 1,0%. Os produtos não incorporados na reação de amplificação serão eliminados utilizando-se o Kit de purificação GFX (Amersham Biosciences) e a purificação do produto amplificado será realizada de acordo com as especificações do fabricante. Todas as amostras serão seqüenciadas, utilizando os iniciadores ITS1 e ITS2, em seqüenciador automático MegaBACE 1000, para a conferência e edição entre as seqüências de cada reação e alinhamento no programa Clustal W (BioEdit) e submetidas no BLAST para uma busca de seqüência armazenada.
Abstract: 
Keywords: Mandioca
endófitos
DNA ribossomal
metadata.dc.subject.cnpq: Ciências Biológicas: Genetica Molecular e de Microorganismos
metadata.dc.language: pt_BR
metadata.dc.publisher.country: Brasil
Publisher: Universidade Federal do Amazonas
metadata.dc.publisher.initials: UFAM
metadata.dc.publisher.department: Ciências Fund. Des. Agrícola
Faculdade de Ciências Agrárias
metadata.dc.publisher.program: Programa PIBIC 2008
metadata.dc.rights: Acesso Restrito
URI: http://riu.ufam.edu.br/handle/prefix/1216
Issue Date: 31-Jul-2009
Appears in Collections:Relatórios finais de Iniciação Científica

Files in This Item:
There are no files associated with this item.


Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.